Sergio Perea @sperea.es Software Developer / Desarrollador
de Software. 🇪🇸 Ⓥ
#Python, #Java, #TypeScript & #JavaScript.
Embracing #CleanCode, #TDD, #XP #DDD
sperea.es
Joan Miralles @joan-miralles.bsky.social 
Mario Montes @mariomnts.bsky.social Tecnología y audiovisual ⌨️ 📺 • Organizador de @T3chFest.es 🤖 • Software Engineer 💻
Isra @gootyfer.bsky.social Cositas de educación y producto
🐍 El Libro De Python 🐍 @ellibrodepython.bsky.social Libro de Python en Español: https://ellibrodepython.com/
3D Stoa - Patrimonio y Tecnología @3dstoa.bsky.social Abrimos ventanas al pasado. Documentación, análisis y difusión del patrimonio y la arqueología gracias a las tecnologías de la informática gráfica.
Más info: 3dstoa.com
Koré @koreformacion.com KORÉ - Formación online en Patrimonio y Tecnología. Ofrecemos los mejores cursos en documentación y diseño 3D aplicados al patrimonio y la arqueología.
Descúbrenos en koreformacion.com 
@sebosin2024.bsky.social @sebosin2024.bsky.social 
Emmanuel Valverde Ramos @emmanuelvalverde.dev Working 👨💻 @ 🏡 | 🎗️ Cancer survivor 🦸♂️ | Crafter working @BavelVoxel, ex-@codurance_es, ex-@_nailted | co-organizer @murciaswcraft | Open Source #bashunit | International speaker | co-author | #XP #TDD #PairProgramming #TBD #DDD
Emma @salamancaperal.bsky.social Tech Talent Acquisition Specialist | El Lado Humano de la Tecnología.De momento, más activa en LinkedIn. Nos vemos por ahí.
Web: https://talentoit.org/
LinkedIn: https://www.linkedin.com
Newsletter: https://www.linkedin.com/newsletters/72174758344025292
Estefania Fernandez @estefafdez.bsky.social QAsita de 💙 y de profesión. Me encanta pillar bugs 🐛, programar tests E2E🌲🎭 y arreglar tests flakys.
Blog (https://unaqaenapuros.wordpress.com/) o en Medium (https://estefafdez.medium.com/)
Más info 🇪🇸🇬🇧: https://estefafdez.github.io/
Cristina Ramos @saffroncr.bsky.social Gamedev, RPGs, retro gaming, electronics, boxing, and trolling
🎮🥊🤓👩🔧⚡🖥️
Making a metroidbrainia game about the end of the world before the end of the world
Itch: https://saffroncr.itch.io/katavatis
Steam: https://store.steampowered.com/app/4843670/KATAVATIS/
Pablo Aparicio / PAR Virtual @parpatrimonio.bsky.social Reconstruyendo en 3D el patrimonio histórico-arqueológico. Autor ilustrador de La Roma de Constantino, publicado con
Desperta Ferro. Más en @3dstoa.com y @koreformacion.com
Jesús Félix Espinosa @jfelixespinosa.bsky.social Loco por Logroño, por La Rioja, por mis hijos, por el basket y el C.B. Sanignacio. Científico loco de profesión y sigo a la SD Logroñés. Es decir, un chalado de narices.
javier ramirez @supercoco9.bsky.social Developer Advocate at QuestDB and all around happy person. Fan of Open Source,Tech Communities,Data&ML.He/him.Ex-AWS,Ex Google Developer Expert
Ester @estergonzalezg.bsky.social Front-End developer en Laberit. Licenciada en ADE. #Feminista, Gallega y #adalaber.
Jess 🌟 @jessvictora.bsky.social Full Stack Developer 💻
Toys and Products Photographer 📸
Mom of twins 🐅🐅
Pokemon Master
Miss Salmonella @misssalmonella.bsky.social María de Toro. Bioinformatician. Sequencing Microbial genomes 🧬. Manager of a Genomics & Bioinformatics Core Facility
#NoSciNoFuture #OneHealth🌏 #FoodSafety #Bioinformatics #MGEs #plasmids
❗️Only science
Cris Pampín @crispampin.bsky.social Tecleo cosas 💻 she/her
Mia Salazar @miadeveloper.bsky.social Soy la pesada de la accesibilidad.
Me gusta meterme en fregaos. Escribo articulitos, doy charlas y soy mentora
Front-end developer
She/Her. Feminista. Friki
Aida Albarrán @aidaispro.bsky.social I changed my career seeking improvement and I'm now #dev at IBMQuantum. Formerly vmware kairos_ds .Constantly absorbing knowledge. Proud #Adalaber.ENFP-A
Mánu Fosela @manufosela.es CTO & AI Strategy at TRIBBU
Focuses in people
Telecomunicactions Engineer
Passionate about Tech & Org. Culture
liderazgoafectivo.com
Advocate4Juniors
@monicamrdam.bsky.social @monicamrdam.bsky.social 
Noemi - Utukku 🍉 @utukku.sanchezdelrio.dev Frontend developer, CSS freak, VUE in training, WoW player, overall nerd, feminist, LGBTIQ+ supporter, ADHD, she/her.
sanchezdelrio.dev
https://bloody-useful.sanchezdelrio.dev/ - Anonymous period tracker
English - Español - Galego
Josedetorre @josedetorre.bsky.social Hice software para bancos, hago software para la administración, haré (hago!) pescatas mitológicas. Nunca me aburro.
====
I did software for a Bank, then to the Gob, and I do fish in my spare time. I never get bored.
meri @minimeri.eurosky.social • A warm heart with a free soul • •Woman in Tech · GIF Sensei · Design · Neuroscience · Horses · Cats • • Nolite Te Bastardes Carborundorum • GCAAGGACATATGGGCGAAGGAGA 🏳️🌈 ❤️💜💙
Jose @joselkan.bsky.social Jack of all none, master of trades.
Sports, travel, videogames and techie-nerdie stuff for me please!
Marcos 🔴🇵🇸 @marcosdlcs.bsky.social Senior Software Developer.
Opinions are my own. Likes and reposts do not necessarily indicate an endorsement.
I'll write in {🇪🇦/🇬🇧}.
🧑💻 #Tech #Programming
⚽ #RM #RMFem
📚 #Books #Reading
🎮 #Videogames
Skeet/Bluit TTL ⏲️ 3mo