- A Adam Seluzicki @aseluzicki.bsky.social
Becky Taylor @beckystaylor.bsky.social Research Scientist at Environment and Climate Change Canada. Conservation genomicist, climber, birder, book worm, and cat friend. She/her. 🇨🇦🦌🧬🧗♀️
Pickle Rick @picklerickau.bsky.social Making common sense more common
MCrim
Hakan Sonok Antalya 0553 802 52 86 @flowmeow1812.bsky.social Hakan Sonok Antalya
@flowmeow1812.bsky.social
Swiftie HAKAN SONOK
@SonokHakan
Parallax @adhanekom.bsky.social Bluesky social page for upcoming Parallax social media app. A new paradigm for navigating the social media cosmos
New York News @newyorktopnews.bsky.social Summarizing top stories from multiple sources, providing actionable facts. Multi-sourced human-curated, New York and beyond.
Posts are not general endorsements of source or imply a relationship.
@epigeneticcongress.bsky.social @epigeneticcongress.bsky.social 
Ching Ching @cclau4neu.bsky.social 
Cameron Dodd @kultarrcam.bsky.social PhD student and certified evolution nerd 🧬
You'll either find me watching birds or chasing mammals 🪿🐨
University of Western Australia + Western Australian Museum
Living and working on Whadjuk Noongar Boodja
Caroline Puente-Lelievre @cpuentelelievre.bsky.social Research fellow @aucklanduni.bsky.social
Structural phylogenetics #strphylo protein evolution, plant systematics
Mel Eckersley-Maslin @meleckmas.bsky.social Lab head in stem cell and cancer epigenetics at PeterMac, UniMelb 🇦🇺🧬
Scientist, mum, dreamer
She/her. Views are my own
www.eckmaslab.com
Putter Tiatragul @puttert.bsky.social Postdoc in the Keogh Lab at the ANU | Macroevolution | Pop Gen | Conservation.
From 🇹🇭, currently living in Ngunnawal country (Canberra, 🇦🇺) | sarintiatragul.com
@aakanksha-kumar03.bsky.social @aakanksha-kumar03.bsky.social 
Australasian Evolution Society - AES @ausevosoc.bsky.social The place to find the latest research, jobs and news from AES 📣
Bringing biologists together to advance evolutionary biology throughout Australasia 🌏 since 1999.
http://ausevo.com/
Maryam Razzaq @maryamrazzaq.bsky.social I am an independent researcher based in Pakistan. My work mainly includes on the investigation of quinoa seed's longevity under adverse conditions such as high humidity, tenperature and micro-gravity. I am open to roles related to seed analysis of crops
@epivec.bsky.social @epivec.bsky.social 
@fangfeit.bsky.social @fangfeit.bsky.social PhD student at UoA. Conservation genetics, cetaceans, ecology, all the above!!
Kutand Alkım Bayer @kutandalkim.bsky.social IZTECH-Chemistry, I like to be Polymath(learning different subjects), Polygot(interested in the learning different languages) comments and opinions are my own RT≠ is not endorsement (he/him)
STRIVE @strivestn.bsky.social Collaborative research network on genome structural variants funded by the European Society of Evolutionary Biology (ESEB).
Cédric Moisy @cedric-moisy.bsky.social Research scientist 🍇🖥️🌱🦠🔬
Plant Pathology | 3D+t imaging | MRI | Xrays tomography | IA | Image Analysis 🔎☢️🧲
Trunk diseases | Fungal Pathogens | Genetics | Molecular Biology | Grapevine | Breeding & Selection
French Wine and Vine Institute, France 🇫🇷
M. Fatih Kara @mfkara.net Plant scientist 🌱 | Plant immunity & MPMI | Necrotrophic fungi: Botrytis & Sclerotinia | Genome editing | Lettuce omics & disease resistance
PhD @york.ac.uk
mfkara.net
Plant Science Spotlight @plant-sci.bsky.social Spotlighting global #plantscience that drives the field forward. We share AI-generated summaries of key papers/news that deserve more eyes, always with source links.
Inbox us a paper link or tag us to be featured. #plantsci
Joanna Achinger @aachinger.bsky.social Lab head in 3D chromatin organisation at SAiGENCI, University of Adelaide 🇦🇺 | Interested in 3D chromatin structure, gene regulation, transposable elements and cancer | website: achingerlab.com
Sam Howitt @samhowitt.bsky.social PhD student at The University of Queensland
Popgen | Genomics | Hybridisation | Mytilus 
Rama @ramzsarvani.bsky.social PopGen | Photography | Travel
@marcialescudero.bsky.social @marcialescudero.bsky.social 
Ben Hanrahan @benhanrahan.bsky.social PhD candidate studying sex chromosome evolution and epigenetics
Faith Adeshola @faithsuccess.bsky.social 
Evelyn Jade @evelynjade42.bsky.social PhD student at the University of Auckland, in the Scotter Lab. I work on bioinformatics and medical genetics, focusing on neurodegenerative diseases caused by repeat expansions in the NOTCH2NLC gene. 🧪🔬🌈🧬
jacobpmoore.bsky.social @jacobpmoore.bsky.social Botanist in Vic - Research noob.
Acacias, genomics, invasion biology...
often found in the grasslands and swamps
Luce Leonard @luceleonard.bsky.social I really love the teachings of the Dalai Lama and the great spiritual masters around him. They make me feel good.
Photo: The Dalai Lama
To my right is Yahne Le Toumelin, Matthieu Ricard’s mother.- A @akamolphat.bsky.social @akamolphat.bsky.social
@grace-auringer.bsky.social @grace-auringer.bsky.social 
Tim Hewitt @tc-hewitt.bsky.social Genomics Bioinformatician at John Curtin School of Medical Research (IID)
Eric Salsburg…Grow The Resistance. @ericsalsburg.bsky.social 🟦Fuck trump, Fuck Fascists, Fuck Netanyahu…Save Our Democracy.
Save us, VOTE BLUE MIDTERMS/2028. LOVE YOUR NEIGHBORS!
Philly Sports Lifer. Animal Rights/Animal Welfare, Climate Change, Human/Civil Rights, Fighting For The Underdog, Standing with Ukraine 🇺🇦
Plant memories @plantmemories.bsky.social We (@joannakacprzyk.bsky.social and @ucdflowerpower.bsky.social) post one plant memory every day from our survey of plant biologists.
Read the paper here: https://doi.org/10.1002/ppp3.70156
La Trobe University (LaTrobeUni) @latrobe.edu.au Real impact starts with action. At La Trobe, you’re shaping the future as part of a community turning ideas into real-world change—advancing sustainability, inclusion, and innovation to transform lives every day.
George Penney @georgepenney.bsky.social Author of funny books, cultural omnivore. I like tea and cats, not necessarily in that order. I inhale deeply when first stepping in to bookshops and libraries. 🌈
https://linktr.ee/Georgepenney
Abhishek @kag91.bsky.social Graduate Student at the Indian Institute of Science.
Phoebe Keddell @phoebeked.bsky.social PhD candidate working on the evolution of hymenopteran sociality 🐝🐜 Comparative, conservation centered genomics 🌠
Lara Muffley @muffley.bsky.social Director of Program Operations (Variant Effects Portfolio) CMAP, CAVA and the Atlas of Variant Effects Alliance | she/her 🏳️🌈
https://fowlerlab.gs.washington.edu/people
https://brotmanbaty.org/research/atlas-of-variant-effects 
Hore Lab @epiotago.bsky.social Lovers of DNA experimenting with Epigenetics, Developmental Genetics, Genomics and Alternative rDNA. Any vertebrate will do!
Mike Rennie @mikerennie.com.au Co-Founder & Co-CEO, mixOmics PRO (current) •
Founder, Human Performance Development
---
Background in Sport Science, Nutrition, S&C, Coaching, Consulting, Digital Transformation & Organisational Strategy & Leadership
-
https://linkedin.com/in/mike-rennie
Wake Botany @wake-botany.bsky.social We put the “Forest” in Wake Forest
#WakeBotany #botany #plantscience
🧪🍄🌿🌴🌲🌻🌎
Nicolás Restrepo @nickseaweed.bsky.social PhD student at a University of Otago 🇳🇿 eDNA, Genomics, Conservation
🌊 Biol. from From 🇨🇴
Dibin Baby @dibinbaby.bsky.social Looking for postdoctoral research opportunities |PhD from @botanyhhu.bsky.social @hhu.de |Researcher @ceplas.bsky.social | Gene & protein engineering 🧬 | Bioinformatics 💻
Timby2 @timby2.bsky.social It's not how much you're given, it's what you do with what you've got. Folk music, archaeology, football and lefty views. Semi-retired, the boss will be furious when she finds out. Looking for hope and laughter.
Soledad Perez Santangelo @solpsantangelo.bsky.social Lecturer at @ScienceUoA
Circadian rhythms in legumes #Medicago @MarsdenFund
Biologist, Yogui 🌱🧘🏻
Buenos Aires, 🇦🇷 - Auckland, 🇳🇿
Lim Chee Liew 刘玲志 @limcheeliew.bsky.social I’m a scientist turned marketing professional, now working as a Marketing Coordinator at Millennium Science, supporting 10x Genomics solutions across Australia and New Zealand.
Thomas L Schmidt @identitybydissent.bsky.social Lecturer and DECRA Fellow at the University of Sydney
Invasion genomics || Wolbachia || Dispersal
https://scholar.google.com.au/citations?user=ipvZJRQAAAAJ&hl
Kotaro Takano @kotarotakano.bsky.social Wildlife disease ecologist studying various cute Aussie mammals including wombats, Tasmanian devils and koalas.
- Detection Dogs for Conservation at University of the Sunshine Coast
Life Science Network @lifesciencenet.bsky.social A platform for life sciences. Publications, research protocols, news, events, jobs and more. Sign up at https://www.lifescience.net.
Altanzul @altanzul.bsky.social Researcher at Institute of Biology, Mongolian Academy of Sciences
@sudiptatung.bsky.social @sudiptatung.bsky.social 
Anna Kearns @annamkearns.bsky.social 
Australian Academy of Science @science.org.au An independent organisation of distinguished Australian scientists, championing science for the benefit of all.
Read our landmark report: https://bit.ly/ASAF2035 #Science2035
Ryan Whitford @rmwhitford.bsky.social A/Prof Ryan Whitford - cereal scientist - whose translatable research outcomes are in wheat reproductive biology. “Nullius in verba.” Opinions are my own.
https://researchportal.murdoch.edu.au/esploro/profile/ryan_whitford
Sheena Chung @sheenachung.bsky.social MSc Biological Oceanography '24 @geomarkiel.bsky.social | Marine biologist wannabe🪸🤿 🌊 | HKU Ecology & Biodiversity '20 | Views are my own | She/her/hers
Helen Fitzsimons @helenfitzsimons.bsky.social PI of Neurogenetics group at Massey University, New Zealand. Likes playing with fly brains to learn about humans
Miles Collier @milescollier.bsky.social …I make no errors, mistakes or blunders…
#DJ 🎶 #Genomics 🧪🧬 #epigenetics 🧪 #epigenomics 🧪🧬 #funky #indie 🎶 #gigs 🎶 Anti- #ParentalAlienation 👨👩👧👦 Pro #EU 🇪🇺; #DJMilesy 🎶 #Cambridge, UK. Life is real good
@accounts-leaving-x.bsky.social @accounts-leaving-x.bsky.social Sharing Accounts That Leave X and Move to Bluesky (since Feb 10, 2025).
Not a bot! Every account that leaves X is discovered and shared manually!
Dawn A Lewis @dawnlewis.bsky.social Australian Centre for Ancient DNA
Gena @genayip.bsky.social MPhil🔬 #salamander #ecology #toxin #parasite #Hong_Kong_newt
Otago Microbiology and Immunology @otagomicroimmuno.bsky.social Department of Microbiology and Immunology at the University of Otago
@melsaligari.bsky.social @melsaligari.bsky.social 
Billy Trim @billy-gene.bsky.social UniAdl: BSc (Adv) (Honours)
Genetics & Evolutionary Biology
CATCTGATCATCGACAGCTAGCACCTGACA
Graham McCulloch @grahammccullochnz.bsky.social Evolutionary biologist @Otago Uni. Researching rapid evolution in New Zealand insects. He/Him
Kimberley Dainty @kdainty.bsky.social Postdoc at Otago University | Genetic Biocontrol Strategies | Previously World Mosquito Program | Genomics Gene-Drive Insects | 🐝 🦟 🧬 🧪
Amanda Black @whenua.bsky.social Researcher, academic, artist, parent and caffeine addicted 
Nat Forsdick @natforsdick.bsky.social Conservation genomics researcher @ MWLR in Aotearoa New Zealand 🧬🐦🐸🐛🌿 | Bird Nerd & President @birdsnewzealand.bsky.social | Secretary @scboceania.bsky.social | pākehā | she/her 🏳️🌈 Opinions are my own.
www.researchgate.net/profile/Natalie-Forsdick/research
Otago Biochemistry @otagobiochemist.bsky.social Department of Biochemistry at the University of Otago
Te Tari Matū Koiora, Ōtākou Whakaihu Waka
Alana Alexander @laninsky.bsky.social I study critters using DNA! 🐳🐬🐋 Ngāpuhi (Te Hikutū), Pākehā. He māmā ahau ki ngā tamariki e toru ki tua o te ārai me te pōtiki kua noho tonu ki te ao nei
Scott Morrissey @scottjmorrissey.bsky.social Marine molecular ecologist | Jellyfish eDNA 🪼, eDNA ecology 🌊, Mapping and monitoring benthic environments 🌱
Southern eDNA Society @sednasociety.bsky.social Promoting science and industry collaboration across Australia and New Zealand to advance best practice eDNA methods and adoption in government, private and community sectors
Nic Rawlence @nicrawlencenz.bsky.social Associate Professor, palaeoecologist, and science communicator @Otago Ancient Ecology Lab Mātai Hauropi Tawhito using ancient DNA and palaeontology to reconstruct past ecosystems.
Nicole Marie Anthony @nicolemarieanthony.bsky.social 🦉Educator
💻Bioinformatics
🧬eDNA
🌱Molecular Ecology
🧫Biotech
🐶French Bulldogs
🥾Exercise is good
🔎 Looking for an unconventional 🧬eDNA project mentor https://www.linkedin.com/in/nicolemarieanthony
Clare I. M. Adams @clare-edna.bsky.social eDNA population genetics, 🧬 herptofauna, indigenous data sovereignty, Pokémon, and everything in between!
Noelle James @noellejames.bsky.social Neuroscientist studying behavioral genetics. General animal lover and science enthusiast.
Edana Lord @edanalord.bsky.social Scientific Officer (Biodiversity Genomics) @ Research Centre for Ecosystem Resilience, Botanic Gardens of Sydney 🌱.
Palaeogenomics | Population Genomics
Currently in 🇦🇺, previously in 🇳🇿🇸🇪
Eilish S. McMaster 🧬🌱 @eilishmcmaster.bsky.social PhD student working on improving conservation genomics for threatened plants 🌿 Focused on methods, frameworks & cross-species insights 🌱 University of Sydney + Botanic Gardens of Sydney (ReCER)
Karina Guo @botanicallykarina.bsky.social 🧬🌿 | Birds | Fish | My Cat
A PhD student with the Botanic Gardens of Sydney and USyd. Working on genetics behind Myrtle rust and paperbarks for restoration.
Tldr: #wetlands #plantdisease #genetics #botany #restoration #ecology
Maurizio Rossetto @mrossettorecer.bsky.social 
Atlas of Variant Effects Alliance @varianteffect.bsky.social Advancing the promise of the Human Genome Project by interpreting the landscape of human genetic variation.
https://www.varianteffect.org
https://www.linkedin.com/company/atlas-of-variant-effects-alliance
#AtlasOfVariantEffects
Audald Lloret-Villas @audald.bsky.social Postdoc - computational, evolutionary and conservation genomics @ the Globe Institute (University of Copenhagen) - 🦜👨🏻💻🧬
One lives only to make blunders.
George Knott @editorperipatetic.bsky.social Editor in Australia now with CSIRO Publishing.
Book ideas welcome: Animals, marine and freshwater, natural environment, food and agriculture, soils, plants & fungi, science and society.
Linktree: Books, contact, and links: https://linktr.ee/editoring
Anna Clark @aclark4444.bsky.social PhD candidate at the University of Otago exploring gene drives in eco-evolutionary models 🐀🧬💻
Junior Einsteins Science Club® @junioreinsteins.bsky.social Award-winning Science events for kids. Founded Ireland☘️ Scientist, Mum, speaker United Nations 🇺🇳 Fun, messy, screen-free hands-on, STEM fun Ireland 🇮🇪 UK 🇬🇧 Canada 🇨🇦 Saudi Arabia 🇸🇦 Luxembourg 🇱🇺 Ukraine 🇺🇦 International Schools partnerships. Franchise.
Ciara Danes @ciaradanes.bsky.social PhD student @ University of Adelaide
Mike Sovic @mikesovic.bsky.social Use DNA to answer questions across the tree of life, from demography to diversity to disease. Scientist. Founder/CSO Freedom Genomics LLC
www.freegenllc.com
#genomics #bioinformatics #bigdata
International Genetic Epidemiology Society @geneticepi.bsky.social Founded in 1991, the International Genetic Epidemiology Society (IGES) is a professional scientific society devoted to the promotion of the study of genetic epidemiology and statistical genetics.
https://www.geneticepi.org/
Valentin Stewart @valentinstewart.bsky.social BSc Genetics & Biomedical Science Student @ the University of Queensland 🫀🔬🧬
Anarqxista @anarqxista.bsky.social 🖤 Scientist by Day, Cosmic Cataclysm at Night.
#resist #resistrfk #nokings #fdjt #fdt #StopICE #defendscience 🧬🧬🧬 🏳️⚧️🤍🏳️⚧️🇺🇦💙🇺🇦
@denis-calan.bsky.social @denis-calan.bsky.social 
Avilien Dard @avdar66.bsky.social #MSCA #Postdoc, Van Breusegem Lab #VIB -UGent Center for Plant Systems Biology #plantscience #redox
https://linktr.ee/Avilien.dard