M. Fatih Kara @mfkara.net Plant scientist 🌱 | Plant immunity & MPMI | Necrotrophic fungi: Botrytis & Sclerotinia | Genome editing | Lettuce omics & disease resistance
PhD @york.ac.uk
mfkara.net
Plant Science Spotlight @plant-sci.bsky.social Spotlighting global #plantscience that drives the field forward. We share AI-generated summaries of key papers/news that deserve more eyes, always with source links.
Inbox us a paper link or tag us to be featured. #plantsci
Joanna Achinger @aachinger.bsky.social Lab head in 3D chromatin organisation at SAiGENCI, University of Adelaide 🇦🇺 | Interested in 3D chromatin structure, gene regulation, transposable elements and cancer | website: achingerlab.com
Rama @ramzsarvani.bsky.social PopGen | Photography | Travel
Sam Howitt @samhowitt.bsky.social PhD student at The University of Queensland
Popgen | Genomics | Hybridisation | Mytilus 
Ben Hanrahan @benhanrahan.bsky.social PhD candidate studying sex chromosome evolution and epigenetics
Evelyn Jade @evelynjade42.bsky.social PhD student at the University of Auckland, in the Scotter Lab. I work on bioinformatics and medical genetics, focusing on neurodegenerative diseases caused by repeat expansions in the NOTCH2NLC gene. 🧪🔬🌈🧬
jacobpmoore.bsky.social @jacobpmoore.bsky.social Botanist in Vic - Research noob.
Acacias, genomics, invasion biology...
often found in the grasslands and swamps
Phoebe Keddell @phoebeked.bsky.social PhD candidate working on the evolution of hymenopteran sociality 🐝🐜 Comparative, conservation centered genomics 🌠
Lara Muffley @muffley.bsky.social Director of Program Operations (Variant Effects Portfolio) CMAP, CAVA and the Atlas of Variant Effects Alliance | she/her 🏳️🌈
https://fowlerlab.gs.washington.edu/people
https://brotmanbaty.org/research/atlas-of-variant-effects 
Hore Lab @epiotago.bsky.social Lovers of DNA experimenting with Epigenetics, Developmental Genetics, Genomics and Alternative rDNA. Any vertebrate will do!
Wake Botany @wake-botany.bsky.social We put the “Forest” in Wake Forest
#WakeBotany #botany #plantscience
🧪🍄🌿🌴🌲🌻🌎
Soledad Perez Santangelo @solpsantangelo.bsky.social Lecturer at @ScienceUoA
Circadian rhythms in legumes #Medicago @MarsdenFund
Biologist, Yogui 🌱🧘🏻
Buenos Aires, 🇦🇷 - Auckland, 🇳🇿
Lim Chee Liew 刘玲志 @limcheeliew.bsky.social I’m a scientist turned marketing professional, now working as a Marketing Coordinator at Millennium Science, supporting 10x Genomics solutions across Australia and New Zealand.
Life Science Network @lifesciencenet.bsky.social A platform for life sciences. Publications, research protocols, news, events, jobs and more. Sign up at https://www.lifescience.net.
Kotaro Takano @kotarotakano.bsky.social Wildlife disease ecologist studying various cute Aussie mammals including wombats, Tasmanian devils and koalas.
- Detection Dogs for Conservation at University of the Sunshine Coast
Thomas L Schmidt @identitybydissent.bsky.social Lecturer and DECRA Fellow at the University of Sydney
Invasion genomics || Wolbachia || Dispersal
https://scholar.google.com.au/citations?user=ipvZJRQAAAAJ&hl
Dibin Baby @dibinbaby.bsky.social Looking for postdoctoral research opportunities |PhD from @botanyhhu.bsky.social @hhu.de |Researcher @ceplas.bsky.social | Gene & protein engineering 🧬 | Bioinformatics 💻
Nicolás Restrepo @nickseaweed.bsky.social PhD student at a University of Otago 🇳🇿 eDNA, Genomics, Conservation
🌊 Biol. from From 🇨🇴
Tim Hewitt @tc-hewitt.bsky.social Genomics Bioinformatician at John Curtin School of Medical Research (IID)
Maryam Razzaq @maryamrazzaq.bsky.social I am an independent researcher based in Pakistan. My work mainly includes on the investigation of quinoa seed's longevity under adverse conditions such as high humidity, tenperature and micro-gravity. I am open to roles related to seed analysis of crops
@fangfeit.bsky.social @fangfeit.bsky.social PhD student at UoA. Conservation genetics, cetaceans, ecology, all the above!!
Putter Tiatragul @puttert.bsky.social Postdoc in the Keogh Lab at the ANU | Macroevolution | Pop Gen | Conservation.
From 🇹🇭, currently living in Ngunnawal country (Canberra, 🇦🇺) | sarintiatragul.com
Mel Eckersley-Maslin @meleckmas.bsky.social Lab head in stem cell and cancer epigenetics at PeterMac, UniMelb 🇦🇺🧬
Scientist, mum, dreamer
She/her. Views are my own
www.eckmaslab.com
Caroline Puente-Lelievre @cpuentelelievre.bsky.social Research fellow @aucklanduni.bsky.social
Structural phylogenetics #strphylo protein evolution, plant systematics
Cameron Dodd @kultarrcam.bsky.social PhD student and certified evolution nerd 🧬
You'll either find me watching birds or chasing mammals 🪿🐨
University of Western Australia + Western Australian Museum
Living and working on Whadjuk Noongar Boodja
@epigeneticcongress.bsky.social @epigeneticcongress.bsky.social 
Australasian Evolution Society - AES @ausevosoc.bsky.social The place to find the latest research, jobs and news from AES 📣
Bringing biologists together to advance evolutionary biology throughout Australasia 🌏 since 1999.
http://ausevo.com/- A @akamolphat.bsky.social @akamolphat.bsky.social
STRIVE @strivestn.bsky.social Collaborative research network on genome structural variants funded by the European Society of Evolutionary Biology (ESEB).
Anna Clark @aclark4444.bsky.social PhD candidate at the University of Otago exploring gene drives in eco-evolutionary models 🐀🧬💻
Audald Lloret-Villas @audald.bsky.social Postdoc - computational, evolutionary and conservation genomics @ the Globe Institute (University of Copenhagen) - 🦜👨🏻💻🧬
One lives only to make blunders.
Maurizio Rossetto @mrossettorecer.bsky.social 
Karina Guo @botanicallykarina.bsky.social 🧬🌿 | Birds | Fish | My Cat
A PhD student with the Botanic Gardens of Sydney and USyd. Working on genetics behind Myrtle rust and paperbarks for restoration.
Tldr: #wetlands #plantdisease #genetics #botany #restoration #ecology
Eilish S. McMaster 🧬🌱 @eilishmcmaster.bsky.social PhD student working on improving conservation genomics for threatened plants 🌿 Focused on methods, frameworks & cross-species insights 🌱 University of Sydney + Botanic Gardens of Sydney (ReCER)
Edana Lord @edanalord.bsky.social Scientific Officer (Biodiversity Genomics) @ Research Centre for Ecosystem Resilience, Botanic Gardens of Sydney 🌱.
Palaeogenomics | Population Genomics
Currently in 🇦🇺, previously in 🇳🇿🇸🇪
Nicole Marie Anthony @nicolemarieanthony.bsky.social 🦉Educator
💻Bioinformatics
🧬eDNA
🌱Molecular Ecology
🧫Biotech
🐶French Bulldogs
🥾Exercise is good
🔎 Looking for an unconventional 🧬eDNA project mentor https://www.linkedin.com/in/nicolemarieanthony
Noelle James @noellejames.bsky.social Neuroscientist studying behavioral genetics. General animal lover and science enthusiast.
Clare I. M. Adams @clare-edna.bsky.social eDNA population genetics, 🧬 herptofauna, indigenous data sovereignty, Pokémon, and everything in between!
Southern eDNA Society @sednasociety.bsky.social Promoting science and industry collaboration across Australia and New Zealand to advance best practice eDNA methods and adoption in government, private and community sectors
Scott Morrissey @scottjmorrissey.bsky.social Marine molecular ecologist | Jellyfish eDNA 🪼, eDNA ecology 🌊, Mapping and monitoring benthic environments 🌱
Alana Alexander @laninsky.bsky.social I study critters using DNA! 🐳🐬🐋 Ngāpuhi (Te Hikutū), Pākehā. He māmā ahau ki ngā tamariki e toru ki tua o te ārai me te pōtiki kua noho tonu ki te ao nei
Otago Biochemistry @otagobiochemist.bsky.social Department of Biochemistry at the University of Otago
Te Tari Matū Koiora, Ōtākou Whakaihu Waka
Nat Forsdick @natforsdick.bsky.social Conservation genomics researcher @ MWLR in Aotearoa New Zealand 🧬🐦🐸🐛🌿 | Bird Nerd & President @birdsnewzealand.bsky.social | Secretary @scboceania.bsky.social | pākehā | she/her 🏳️🌈 Opinions are my own.
www.researchgate.net/profile/Natalie-Forsdick/research
Amanda Black @whenua.bsky.social Researcher, academic, artist, parent and caffeine addicted 
Kimberley Dainty @kdainty.bsky.social Postdoc at Otago University | Genetic Biocontrol Strategies | Previously World Mosquito Program | Genomics Gene-Drive Insects | 🐝 🦟 🧬 🧪
Graham McCulloch @grahammccullochnz.bsky.social Evolutionary biologist @Otago Uni. Researching rapid evolution in New Zealand insects. He/Him
Billy Trim @billy-gene.bsky.social UniAdl: BSc (Adv) (Honours)
Genetics & Evolutionary Biology
CATCTGATCATCGACAGCTAGCACCTGACA
Otago Microbiology and Immunology @otagomicroimmuno.bsky.social Department of Microbiology and Immunology at the University of Otago
Gena @genayip.bsky.social MPhil🔬 #salamander #ecology #toxin #parasite #Hong_Kong_newt
Dawn A Lewis @dawnlewis.bsky.social Australian Centre for Ancient DNA
Miles Collier @milescollier.bsky.social …I make no errors, mistakes or blunders…
#DJ 🎶 #Genomics 🧪🧬 #epigenetics 🧪 #epigenomics 🧪🧬 #funky #indie 🎶 #gigs 🎶 Anti- #ParentalAlienation 👨👩👧👦 Pro #EU 🇪🇺; #DJMilesy 🎶 #Cambridge, UK. Life is real good
Helen Fitzsimons @helenfitzsimons.bsky.social PI of Neurogenetics group at Massey University, New Zealand. Likes playing with fly brains to learn about humans
Sheena Chung @sheenachung.bsky.social MSc Biological Oceanography '24 @geomarkiel.bsky.social | Marine biologist wannabe🪸🤿 🌊 | HKU Ecology & Biodiversity '20 | Views are my own | She/her/hers
Ryan Whitford @rmwhitford.bsky.social A/Prof Ryan Whitford - cereal scientist - whose translatable research outcomes are in wheat reproductive biology. “Nullius in verba.” Opinions are my own.
https://researchportal.murdoch.edu.au/esploro/profile/ryan_whitford
Australian Academy of Science @science.org.au An independent organisation of distinguished Australian scientists, championing science for the benefit of all.
Read our landmark report: https://bit.ly/ASAF2035 #Science2035
Anna Kearns @annamkearns.bsky.social 
Nic Rawlence @nicrawlencenz.bsky.social Associate Professor, palaeoecologist, and science communicator @Otago Ancient Ecology Lab Mātai Hauropi Tawhito using ancient DNA and palaeontology to reconstruct past ecosystems.
Dovetail Genomics @dtgenomics.bsky.social 🧬 The Genome • Unrestricted 🧪
Birds New Zealand (OSNZ) @birdsnewzealand.bsky.social Te Kāhui Mātai Manu o Aotearoa | The Ornithological Society of New Zealand - for all things birds in Aotearoa New Zealand. www.birdsnz.org.nz
Valentin Stewart @valentinstewart.bsky.social BSc Genetics & Biomedical Science Student @ the University of Queensland 🫀🔬🧬
International Genetic Epidemiology Society @geneticepi.bsky.social Founded in 1991, the International Genetic Epidemiology Society (IGES) is a professional scientific society devoted to the promotion of the study of genetic epidemiology and statistical genetics.
https://www.geneticepi.org/
Cédric Moisy @cedric-moisy.bsky.social Research scientist 🍇🖥️🌱🦠🔬
Plant Pathology | 3D+t imaging | MRI | Xrays tomography | IA | Image Analysis 🔎☢️🧲
Trunk diseases | Fungal Pathogens | Genetics | Molecular Biology | Grapevine | Breeding & Selection
French Wine and Vine Institute, France 🇫🇷
Mike Sovic @mikesovic.bsky.social Use DNA to answer questions across the tree of life, from demography to diversity to disease. Scientist. Founder/CSO Freedom Genomics LLC
www.freegenllc.com
#genomics #bioinformatics #bigdata
Avilien Dard @avdar66.bsky.social #MSCA #Postdoc, Van Breusegem Lab #VIB -UGent Center for Plant Systems Biology #plantscience #redox
https://linktr.ee/Avilien.dard
Earth BioGenome Project 🌍 @ebpgenome.bsky.social 🧬 Sequencing biodiversity. Securing its future.
The Earth BioGenome Project (EBP) is a global moonshot for biology working to sequence, catalog, and characterize the genomes of Earth’s eukaryotic biodiversity.
🌍 Follow us:
linktr.ee/earthbiogenomeproject
ARC Centre of Excellence in Plants for Space @plants4space.bsky.social Official account of the ARC Centre of Excellence in Plants for Space (P4S), an international research consortium building novel solutions for long term space habitation and on-Earth sustainability.
www.plants4space.com
Ulrike Bechtold @ubechtold.bsky.social Accociate Professor at Durham University
Henry North @henrylnorth.bsky.social Research Fellow at Girton College, Cambridge
Population genomics, invasive species, hybridization, adaptation, structural variation
Australian Society of Plant Scientists (ASPS) @asps-oz.bsky.social The Australian Society of Plant Scientists (ASPS) promotes #PlantScience in Australia, and provides professional contact within our community #ASPS2025 #ozplants
https://asps-oz.github.io/asps-links/
Simon Williams @williamsanu.bsky.social A/Prof Research School of Biology, ANU
Tammy Steeves @testeeves.bsky.social 🇨🇦 Prof at UC in Aotearoa New Zealand 🇳🇿 #WearsManyHats #JugglesManyBalls incl Conservation Genomics #ConSERTeam🧬 IUCN SSC Conservation Translocation Specialist Group🕊️ PI @tepunahamatatini.bsky.social #KindnessInScience🔬 Opinions are my own. 
Annie G West @anniegwest.bsky.social Postdoctoral Research Fellow @ University of Edinburgh
🦠 Ancient Microbiomes 🧬 Dabbling in PopGen 🐻 Population Declines 🐾
previously @ University of Auckland 🇳🇿
Avid hiker and book worm 🐛
https://anniegwest.wixsite.com/anniegwest
Bondada @bondada.bsky.social Postdoc at Max Planck institute for Biology - Langer's Lab.
Interested in min-chromosomes, Haploid induction, epigenetics, genome stability, Arabidopsis, Magnaporthe. https://scholar.google.com/citations?user=Qlbm2YcAAAAJ&hl=en
Chris Simms @chrisnsimms.bsky.social Science journalist covering all fields. Formerly an editor at New Scientist and Nature. 🧪🐸 🍄
New Scientist: https://tinyurl.com/2tvwfa2b
Live Science: https://tinyurl.com/4mbyh7a9
Sci Am: https://tinyurl.com/bdza74ta
Nature: https://tinyurl.com/yc265esp
Francis Kuang @franciskuang.bsky.social PhD Student at The University of Melbourne
Flo Camus @fcamus.bsky.social NERC Independent Research Fellow based at University College London 🇨🇱🇦🇺🇬🇧
Nuts about mitochondria & mito nuclear epistasis. Interested in sexual conflict, diet & metabolism.
Associate Editor: Evolution Letters
Liu Wang @leoliuwang.bsky.social Senior Research Fellow #SingleCell | #SpatialTranscriptomics
https://256wangliu.github.io/
Marco Podobnik @mpodobnik.bsky.social Walter Benjamin Fellow at @armilabs.bsky.social Melbourne interested in all things developmental, regenerative, and evolutionary biology. @mpi-bio-fml.bsky.social alumnus. https://marcopodobnik.wordpress.com/
Annet Kirabo D.V.M., M.Sc., Ph.D., F.A.H.A. @annetkiraboc1.bsky.social Professor @VanderbiltHealth #Hypertension, #kidney, #immunology #HostMicrobiotaInteraction. Mother of 2, wife. Associate Editor @CircRes
Alex Fraik @akfraik.bsky.social Research scientist | Evolution, pop gen & conservation genomics | views & typos are my own | 🐟🐺🧬
Andrea Schraven @andreaschraven.bsky.social Postdoctoral research associate at the University of Sydney, applying genetic data and computational modelling to inform threatened species management.- A Anna Santure @annasanture.bsky.social she/her
Rob Lanfear @roblanfear.bsky.social phylogenetics, molecular evolution, some genomes, kids, dogs, and eclectic hobbies none of which I am much good at but I think for me that's the point
Scott Keogh @keoghlabanu.bsky.social Ecology & Evolution, Research School of Biology, Australian National University
KeoghLab.com
Emily Roycroft @emilyroycroft.bsky.social Evolutionary biologist • Head of the Evolutionary & Conservation Genomics Group at Monash University • ARC DECRA Fellow • genomics • museums • phylo • conservation • #ozmammals • she/her • Wurundjeri & Bunurong Country, Australia
David L Field @dlfield.bsky.social Evolutionary biologist at MQ (Wild Plant Genomics). Genomics, speciation, adaptation, mating systems, flower colour, genetic rescue, conservation and restoration, plant-pollinator interactions. Snapdragon, kangaroo paw, Eucalypt enthusiast
Clare Holleley @clareholleley.bsky.social Head of Vertebrate Research Collections @CSIRO 🦎🥚🪶🧬 | Epigenomic Time-Machine | Evolution | Genomics | Reptile Sex Determination | Mother | STEMinist
Tim Cutajar @timcutajar.bsky.social Environmental DNA and molecular ecology, how and where it can impact conservation 🐸🐍🦟🩸🧬
Teranga Wildlife @terangawildlife.bsky.social https://linktr.ee/terangaranch
Native wildlife education in Southern CA. Our favorite members of the native wildlife community include mountain lions, bears, coyotes, bobcats, raccoons, opossums, birds of prey and reptiles. Los Angeles & Ventura
Anna Frances Probert @afprobert.bsky.social From Aotearoa, now a Lecturer based at UNE in NSW 🇦🇺 Non-native species, biosecurity, ecology & entomology. Loves ants 🐜 I always RT ecology jobs & PhD opps. She/her
Lee Rollins @lee-rollins.bsky.social Molecular Ecology of Invasive and Conserved Species
Bastien Llamas @dnatimetravel.bsky.social Archaeo/palaeogeneticist, soccer player, kitesurfer, hiker, sweet tooth, world citizen, globe trotter, fascinated by the natural world. My tolerance of haters is limited.
He/him
Bethany Brookshire @beebrookshire.bsky.social Sci journo, author of Pests: How Humans Create Animal Villains. Highly caffeinated. All bad takes mine. She/her
Society for Conservation Biology @society4conbio.bsky.social The premier international org of professionals who dedicate their work to advancing the science & practice of conservation.
Visit conbio.org to join. 
Catherine Grueber @cegrueber.bsky.social Conservation biologist at The University of Sydney using population genetics, statistics and collaboration to help preserve biodiversity. Views my own.
William Pearman @williampearman.bsky.social Research fellow at Auckland Uni. Wannabe bioinformatician, reluctant community ecologist. Evolutionary ecology, microbial ecology. Anglican. He/him
Gernot Segelbacher 🪶 🧬 @gsegelbacher.bsky.social professor at university Freiburg, ornithologist, conservation geneticist,
❤️outdoors, mountains ⛰️, open water swimming 🏊 and birds 🦤 (not necessarily always in this order, but sometimes all together)
#teamscience, #teamvorsicht #lowcarbonbirding
Margaret Stanley @ecostanley.bsky.social Professor, University of Auckland: urban ecology, conservation, invasive species. Mum to 2 teenagers. Nature fan. She/her. Aotearoa - New Zealand.
UOA profile: https://profiles.auckland.ac.nz/mc-stanley 
Jemma Geoghegan @jemmageoghegan.bsky.social Professor at University of Otago, NZ; Webster Chair in Virology; Rutherford Discovery Fellow. I like viruses and evolution.