Riki Blanco @rikiblanco.net www.rikiblanco.net
Biblioteca Nacional de España @bne.es Bienvenidos a la cuenta oficial en Bluesky de la Biblioteca Nacional de España.
🔗 bne.es
Finnerty Steeves @finnertysteeves.bsky.social Co-Founder @ Intrinsic Entertainment Collaborative 🦋 Actor, Screenwriter, Mom. Big fan of kindness. My film “before/during/after” is currently free on Prime!
#actor #screenwriter #indiefilm #womeninfilm #film
@INFOCAM @infocam.bsky.social Perfil oficial del Servicio de Prevención y Extinción de Incendios Forestales de @gobjccm.bsky.social
marieta @marietadelui.bsky.social Ja no estic a temps de farmejar aura, oi?
Open Source Design @opensourcedesign.net 🎨 Design + Open Source
💬 Discuss https://discourse.opensourcedesign.net
💸 Donate http://opencollective.com/opensourcedesign #opensourcedesign
opensourcedesign.net · https://mastodon.social/@opensourcedesign
Puño @puno.bsky.social Viejo y guapo.
La Nave Nodriza @nodrizismo.bsky.social Espacio de reflexión y aprendizaje en torno a los productos y servicios digitales, practicando competencias del S XXI y retos ODS.
El FAX newsletter mensual → http://bit.ly/3tGVkSU
Alexandria Ocasio-Cortez @aoc.bsky.social Waitress turned Congresswoman for the Bronx and Queens. Grassroots elected, small-dollar supported. A better world is possible.
ocasiocortez.com
CMAT @cmatbaby.bsky.social short irish woman who made those two amazing albums that everyone loves
Marina Aísa @marinaaisa.com I'm a software engineer at Apple , focused on making web products more accessible and enjoyable 👩🏼💻
🏳️🌈 Opinions are my own
📍 London, UK
https://marinaaisa.com/
Astro @astro.build the web framework for content-driven websites 🚀 https://astro.build
Eoghan Sweeney @eoghan.eurosky.social Eoġan mac Suiḃne
Journalist; trainer, immigrant
osintessentials.com
Also @osintessentials.bsky.social
Sligo Rovers 500 Club member
adara @adarasanchez.bsky.social Illustrator and npc
adara.sanchez@gmail.com
Giopota @giopota.bsky.social Pink mage casting gay spells on you 🏳️🌈 (he/him) – Artist of DC Comics' THE MAGICAL MYSTERIES OF SHAZAM! and author of MOTHERSEA.
giopota@gmail.com
Diana @dianaaceves.com Melómana.
Feministísima.
Pucelana viviendo el sueño asturiano.
Software developer.
Digo muchos tacos aunque me gustaría decir menos.
She/Her
ascárida @ascarida.bsky.social 💻 Obreira do pixel
🌵 Riquiña e rabuda
🐶 Persoa favorita de Boo
🍋 Bebo Bitter Kas e como limóns
itch.io @itch.io Open indie game marketplace and DIY game jam host
Account support? Email support@itch.io
❗📢 You can use your itchio URL as your Bluesky username, check here: https://itch.io/user/settings/bluesky
@lowfill.bsky.social @lowfill.bsky.social 
Alba Martín Campos @amartinc.bsky.social Periodista visual en SUR / Datos, visualización e infografía | ✉ amartin@diariosur.es
Enrique Bordes @comicarchitect.eurosky.social Tebeoarquitecto y museografista. Autor de "Cómic, arquitectura narrativa", comisario de "Beatos, mecachis y percebes" en la Biblioteca Nacional y “Contar un monte de Oro” en RAE Roma, coautor de la cartografía “Madrid Bombardeado” junto a Luis d Sobrón
Ce @modernghosts.eurosky.social Una rata con ojos de campo.
Stoat @stoat.chat 💬📲🖥️ the open-source chat app built with you in mind • check us out on https://stoat.chat • dms welcome anytime
@fitovazquez.bsky.social @fitovazquez.bsky.social 
Estado parques de Madrid @estadoparques.bsky.social Bot que informa cuando se produce un cambio en el estado de los parques de Madrid. Hecho por @kokuma.bsky.social. Código disponible en https://github.com/juanalonso/estado-parques-madrid
Cristina Ramos @saffroncr.bsky.social Gamedev, RPGs, retro gaming, electronics, boxing, and trolling
🎮🥊🤓👩🔧⚡🖥️
Making a metroidbrainia game about the end of the world before the end of the world
Itch: https://saffroncr.itch.io/katavatis
Steam: https://store.steampowered.com/app/4843670/KATAVATIS/
Jane Ng @janeng.com Director of Doing Nothing. Used to build game worlds and now builds studios. Prev: Ops @ Gardens, Half-Life: Alyx (Valve), Firewatch (Campo Santo). Etc. Immigrant. She/her. Opinions are mine.
🐱 http://www.janeng.com
Belén 😱 @ladybenko.net Software engineer and game developer https://ladybenko.net. 🏳️🌈 She/Her.
Escribo ci-fi y fantasía en https://benkoalbeza.com
Hugo Tobío @hugotobio.bsky.social Hago que las cosas sucedan - Creativo, Branding, Web, motion - www.hugotobio.com
Crystal @ Ciss Outdoors @cissoutdoors.bsky.social Independent outdoor publication shaped by time spent outside.
Hiking, outdoor travel, judgement, and gear that earns its place.
Long-form articles at www.cissoutdoors.co.uk
Xabibenputa @xabibenputa.bsky.social Noble por nacimiento, valiente y sufrido por naturaleza. 
European Commission @ec.europa.eu News and information from the European Commission. Social media and data protection policy: http://europa.eu/!MnfFmT
Zohran Kwame Mamdani @zohrankmamdani.bsky.social Mayor of New York City
Misty De Méo @cdrom.ca Game history, programming, nonsense.
Multimedia blog: https://cdrom.ca
Andreas Finger 🇪🇺 @mediafinger.com Living the #VanLife 🚐 all over Europe 🇪🇺
formerly strongly involved in the #Ruby and #Rails communities of #Barcelona 🇪🇸 and #Hamburg 🇩🇪
you might know me as 'Señor Developer' from conferences - #Freelancer at day - side-project #Developer at night
Asier @asier.io Taking a break. Asynchronous collaboration, decentralization and coffee. GitHub Alumni.
Valeria Castro @noval33t.bsky.social Making 🌹 Mythic Love: Iberian Legends at @platonicgames.bsky.social / https://store.steampowered.com/app/2654990/Mythic_Love_Iberian_Legends/?l=spanish
EuroAlternative @euroalternative.eu Discover European alternatives to big tech companies → https://euroalternative.eu
Curated by @kulpinski.dev
Txarly @txarly.bsky.social Sin tirar una línea de código desde 2014.
Ahora: @indemniza_me cofounder.
mastodon: @txarly@mas.to
Javi @sansonero.bsky.social Prettyoliviarecords.bandcamp.com
AEMET @aemet.es Cuenta oficial de la Agencia Estatal de Meteorología.
Petite @petitebrunette.bsky.social Nada más que añadir.
IG @thepetitebrunette
zoraidazaro @zoraidazaro.bsky.social Dibujo, escribo, coloreo y hago otras cosas que luego soy incapaz de recordar.
Bloqueo directo a usuaries de IAgen.
Arrea Iacta Est.
Blippo+ @blippo.plus Channel Surf ✺ New Wave ⚡︎ Television
🎬 Out Now on Nintendo Switch, Steam, & Mac
📡 Broadcasting Weekly on Playdate
🏆 Apple Design Awards 2026 Finalist
🏆 Best Writing in a Game NYGA 2026
🏆 4x IGF 2026 Nominee
https://blippo.plus
Graphite - Open Source Graphics Suite @graphiteeditor.bsky.social Open source 2D raster & vector editor that melds traditional layers & tools with a modern node-based procedural workflow. #MadeWithGraphite
Website: https://graphite.art
Hank Green @hankgreen.bsky.social Long Time Internet Guy
Vladimir Raskolnikov @almantor.bsky.social Costumbrismo mustio
Rosa @rosa.codes 🇪🇺 European ❤️ cities, maths, theoretical computer science, learning languages, puzzles & bicycles 🐶 Human to Mochi 👩🏻💻 Principal programmer @ 37signals - she/her - Antwerp 🇧🇪 / Madrid 🇪🇸
Sarybomb 🔞 @sarybomb.bsky.social 🔞🏳️🌈 Queer erotic comics. They/them.
I make pathetic protagonists go through it
Comics: sarybomb.com
Shop: sarybomb.com/shop
Support: patreon.com/sarybomb
📩 Sarybomb@gmail.com
meri @minimeri.eurosky.social • A warm heart with a free soul • •Woman in Tech · GIF Sensei · Design · Neuroscience · Horses · Cats • • Nolite Te Bastardes Carborundorum • GCAAGGACATATGGGCGAAGGAGA 🏳️🌈 ❤️💜💙
Kaoxita @kaoxita-art.bsky.social 🏳️🌈 Daydreaming a way of life
🖍️ Illustrator & Colorist & Comic Artist
💜 Working at @sextoriesmagazine
🌍Barcelona
Eva @evaac.bsky.social A favor dels drets humans, la ciència, l’art i el sentit comú. És a dir, contra les fake news i l’extrema dreta. Parlo de la transformació dels mitjans de #comunicació, #datajournalism i crisi climàtica
Ale Striuk @striuk.bsky.social En las nubes
Mucks! Games @mucksgames.com Award winning tiny indie game studio
3 friends making meaningful & beautiful games
Check out Frieda is Changing:
https://www.kickstarter.com/projects/mucksgames/frieda-is-changing
https://store.steampowered.com/app/2802730/Frieda_is_Changing/
Balatro @playbalatro.com Balatro is a poker-inspired roguelike deckbuilder.
Mobile: http://playbalatro.com/mobile
Steam, PS, Switch & Xbox:
http://linktr.ee/balatrogame
🇨🇦
Sam @samvgm.bsky.social Product Designer
CSS, UI and design bits.
📍Vigo, Galicia, Spain
Fun polo aire e vin polo vento
Rubén Ortiz @rubnortz.bsky.social Product manager, curioso del comportamiento humano, inclusión y diversidad 🏳️🌈 Fodechinchos pero riquiño | Diseño | Producto | Cine | Otros
Anslo @anslo.dev 3D developer and creative generalist, currently working on slowroads.io. Interested in architecture, 3D design, digital fabrication, procedural generation, and web-based graphics. Check out anslo.dev for details
Slow Roads @slowroads.io Seek the peace of a long, scenic drive through endless procedurally-generated landscapes.
Play free at slowroads.io - no ads, no logins, just roads.
Wishlist on Steam - https://store.steampowered.com/app/3431300/Slow_Roads/
From @anslo.dev
🔞 Marcel Massegú 🔞 @coffeedungeon.bsky.social Kinky stuff goes here!
🔴 He/Him
🔴 Art director in Sextories Magazine
🔴 Unlimited amount of puns
⭐Bi, Poly & totally NSFW ⭐
‼️+18 ONLY‼️
READ MY COMIC "CROSSROADS" HERE: https://sextories.net/en/comics/
Daniel Torres Burriel @torresburriel.com Founder & CEO Torresburriel Estudio
Global Strategy Lead UX-PM
Professor UX Learn, ESIC, USJ, UPF Barcelona, Startups Institute
Author x3
UXalliance 🇪🇸
UXPA Spain Chair
Design with purpose, impact with experience
bit.ly/torresburriel
Pablo Domínguez @pabsdominguez.com Designer.
Geek dad / Generation X / 🇪🇸 → 🇬🇧 Some tweets in Español.
Currently: Product Design Team lead @JustEatTakeaway
tinybigstudio.com
Fernando Espinosa @handle.invalid Apps builder
Javier @javier.bsky.social Working wonders with wile, whimsey, and wit.
https://javier.computer
https://poetical.day · https://binocularshot.com · https://booksaboteur.com
kepano @stephango.com making @obsidian.md
Alfonso Uceda @alfonsouceda.eurosky.social Software Engineer. Ruby. Rails. DevOps apprentice
Proton @proton.me Choose a better internet where privacy is the default. Start protecting your personal information online with Proton Mail, Proton VPN, Proton Drive, Proton Pass, Proton Wallet, and Lumo: https://proton.me/
Jacobo García @jacobogarcia.bsky.social Ever mutating. Living in the intersection of culture, design, strategy & tech. DJ (Clap Kent) & Producer (Sculptures). Editor at Clot Mag. Liminal Agency.
🔗 🌳 https://linktr.ee/clapkent
🎧 🛠️ https://quantumflexor.tumblr.co
Bookings: atzla.booking@gmail.com
Joako @joako.bsky.social Iterando mi propia narrativa. Disculpen las molestias.
Luis Armesilla @luis-armesilla.bsky.social Diseño de producto.
Marilyn Brown @marilynbrown.bsky.social A veces Marilyn Brown, a veces simplemente Verito
Álvaro @allvaro.eurosky.social A romantic designer
alvaroramis.com
sieyin @sieyin.eurosky.social Proletario sin prole.
#FreePalestine 🇵🇸 · #ACAB ✊
Toni_batres @tonibatres.bsky.social Director de SextoriesMagazine, storyboard y 2D visual artist at Stumble Guys Dibujando y reivindicando la sexualidad IG:
@toni_batres
Idioto a tiempo completo
EvaSan @evasan.bsky.social Escribo y diseño 💖
David @davidrodriguez.es Front-end. Previously @mcdave on twitter
Randall Munroe @xkcd.com 
Neven Mrgan @mrgan.com Creative Lead at Panic, working on Playdate, dev software, and helping publish games • Maker of games Blackbar, Grayout, Hidey Spot, The Barkless Doctrine, The Incident, Space Age, Stagehand • One of the good ones • Portland, OR • he/him
Cabel Sasser @cabel.panic.com I work at https://panic.com
Find me at https://cabel.com
📍Portland, OR
Panic @panic.com panic.com • Maker of apps (Nova, Prompt, Transmit) • Publisher of Firewatch, Untitled Goose Game, Nour: Play With Your Food, Thank Goodness You're Here, Arco, Despelote, Time Flies • Oh, and also @play.date
Playdate @play.date A brand new handheld video game system from Panic.
➡️ Available at https://play.date
💬 Need help? Go to https://help.play.date
Sergi 🏳️🌈 @sdepazos.bsky.social Usuario Extremísimo: Proud Creative Problem Solver in a neurospicy queer vessel.
Diseño estratégico | narrativa | UX | ex-dev | history | mindsets | VR.
Previously founder of @whymapsnet & @theinstituto, also @Nodrizismo profealumni
🔗 sergio.depazos.com
Mel @mmecurry.bsky.social 
sara 🍉🇪🇸🍉🇪🇺🍉 @saramedia.eurosky.social Made in Castile.
🇪🇸 / 🇬🇧
No place to hide. Genocide is happening under your nose. Relativism is just cowardice on pedantry.
ella/she
Manuel Bartual @manuelbartual.bsky.social Guionista y entusiasta. Creador de Biotopía. Cocreador de Santuario, Blum, Místicas y Titania. A veces me pasan cosas raras.
✨ manuelbartual.com
Silvia Hernández @silviahdez.bsky.social Design + pottery + urban studies.
David @demimismo.bsky.social 
Irene Estrada @echarunremiendu.bsky.social Intervalos de nubes y claros, con posibilidad de lluvia.
Sgrsgr @sugarsagar.bsky.social asymmetric & atypical.
Carlos de Toro @carlosdetoro.bsky.social 🌈 Type & Visual Designer.
I craft and code typefaces for brands. Font Developer @ DaltonMaag. (#TypeMedia ‘19).
📍Spaniard in London - https://instagram.com/carlosdetoro/
Ada Colau @adacolau.bsky.social Former Mayor of Barcelona (2015-2023)
Avui a @fundaciosentitcomu @barcelonaencomu
La humanitat està en joc a Gaza #freepalestine🇵🇸
Raquel Lainde @lainde.bsky.social #Diversidad #Inclusión #Comunicación #TransformaciónDigital
En ratos libres busco la forma de entender el mundo con la quijotesca intención de mejorar mi parte.
toribio, andrea @apitaera.bsky.social 🪞 my heart is Pegasus colors
jmarquez @jmarquez.com Cocinero por afición, UX por profesión y padre de perro por suerte. Chileno de nacimiento, español de adopción.
linkedin top voice @marinavega.bsky.social la artista anteriormente conocida como buenapava
Ana Nuñez @ananunez.bsky.social X-1
Carmen Lanza @carmenlanza.bsky.social 
Sonia Luna @superenserio.bsky.social Esto de las #RedesSociales me lo tomo super en serio.
🌍Digital Communications & Social Media en Greenpeace.es