Irene Farabella @iosonoirene.bsky.social 💻 🧬 3D genome & RNA lovers Group Leader at Center for Human Technologies, Italian Institute of Technology | CDA @ArmeniseHarvard
ConGen @congencourse.bsky.social ConGen is an international conservation genetics course, now in its 30th year. This training program uses hands-on training to teach young researchers to use genomics techniques and tools to make real-world decisions. http://congenglobal.org
Brendan Hayward @bmjhayward.bsky.social software dev, sci tech, bioinformatics, current events, proud father. Some games, memes sprinkled throughout
Carolina Armijos @carmijos.bsky.social 🇪🇨 | PhD student in Quantitative Biology at UNC | Studying m6A, pseudouridine, m5C, and other RNA mods | Transcriptomic regulation across species | Computational genomics
Dr. Arun Sethuraman @arunsethuraman.bsky.social Computational evolutionary biologist. Professor & Chair of Biology @sandiegostate.bsky.social, athlete, insomniac, writer, singer, polyglot, polymath, @out.com ‘25 Out100 honoree. He/him. 🏳️🌈🇮🇳🇺🇸🐞🌱🐢🧬🏋🏾♂️🎤✍🏾 www.sethuramanlab.com Views are mine alone.
betancur . n @nelbeu.bsky.social art & architectural historian / visual, material & religious culture
Anthony Geneva @anthonygeneva.bsky.social Evolutionary genetics. Associate Professor @ Rutgers—Camden genevalab.io
@allcell9.bsky.social @allcell9.bsky.social 
X-POD TECH LLC™ @xpodtech.com “A global technology leader developing advanced occupant‑safety solutions, including the Safety‑X‑Pod®—an ejectable, crash‑proof passenger cocoon with an integrated Environmental Control and Life Support System.” https://xpodtech.com/
GenomeTDCC @genometdcc.org Technology Development Coordinating Center at NHGRI. Advancing innovation in genomic technology development through collaboration, promoting standards, and outreach in conjunction with The Jackson Laboratory 🧬💻🧪
Billy Trim @billy-gene.bsky.social UniAdl: BSc (Adv) (Honours)
Genetics & Evolutionary Biology
CATCTGATCATCGACAGCTAGCACCTGACA
Laurie O'Neill @laurieparrot.bsky.social PhD parrot cognition, now working in bioscience funding strategy
Audald Lloret-Villas @audald.bsky.social Postdoc - computational, evolutionary and conservation genomics @ the Globe Institute (University of Copenhagen) - 🦜👨🏻💻🧬
One lives only to make blunders.
Genetics Society of AustralAsia @geneticsaus.bsky.social Genetics Society of AustralAsia. Professional organisation for genetics and genomics researchers and educators in Australia, New Zealand & the Asia-Pacific region.
genetics.org.au
Banner image by Marta Portela
@theodanis.bsky.social @theodanis.bsky.social PhD candidate | Vanderbilt University @VanderbiltU | @RokasLab | Bioinformatics, Phylogenomics, Genomics,Life history traits evolution in mammals
Canadian BioGenome Project 🇨🇦 @canadianbiogenome.bsky.social The goal of the Canadian BioGenome Project is to produce high-quality reference genomes 🧬 for all Canadian species 🌎
Sequencing Canada's Biodiversity 🌿🦋🐍🧬🐢🦌🐸🌳🐿🐙🦈🦦
Learn more: https://linktr.ee/canadianbiogenome 
@PhysGenCenter @physgencenter.bsky.social The mission of the Center for Physical Genomics and Engineering at Northwestern University’s McCormick School of Engineering is to create new strategies for the treatment of disease and the reversible manipulation of living systems 
Djoser Genomics @djosergenomics.github.io Exploring #SyntheticBiology & #Bioinformatics + Documenting my learning journey | Built by @noureldenrihan.bsky.social | 🌐 djosergenomics.github.io
Dr Veronica Radice @drradice.bsky.social Data Scientist | Smithsonian Institution (remote - Australia). Love all things biodiversity, ecology, coral reefs, mesophotic, stable isotopes
Alum | University of Queensland, Coral CoE, Johns Hopkins
Hiker, brewer, mango farmer
@sujana-ghosh.bsky.social @sujana-ghosh.bsky.social 
Fabian Salgado-Roa @facasaro.bsky.social Evolutionary biologist. Stengl-Wyer postdoc fellow at @texas-ib.bsky.social. I like colorful spiders
#CienciaCriolla
https://fcsalgado.github.io/
Anna MacDonald @annamac.bsky.social Uses DNA to study wildlife | plays hockey 🏑 | drinks tea | hikes | adventures with dogs | open heart surgery x2
#conservation #genetics #consgen #eDNA #ecology #Antarctica #biodiversity #seabirds #marsupials #WildOz
Live in lutruwita / Tasmania 🇦🇺🇬🇧🏳️🌈 she/her
@hornblad-lab.bsky.social @hornblad-lab.bsky.social 
Des Moines Local @glioblaster.bsky.social Mass follower dying of glioblastoma. I'll follow as much as I want. Don't follow if it bothers U. Politics,Music,food & #DesMoines #Iowa. I don't represent any recommendations I share. 🚫DMS. 🚫SOLICITING. IF SOMETHING IS CENSORED ITS PROBABLY A ALBUM COVER.
Silvia Remeseiro Lab @remeseiro-lab.bsky.social Associate Professor & Docent @umeauniversitet.bsky.social
Wallenberg Fellow in Molecular Medicine at WCMM Umeå
Postdoc @embl.org
PhD @cniostopcancer.bsky.social
3D genomics , epigenomics, gene regulation, enhancer, cancer, glioblastoma, cancer neuroscience
Scott Givan @sag99.bsky.social Director of the Van Andel Institute #Bioinformatics and #Biostatistics Core. @sgivan on X.
Miguel Montez @miguelmontez.bsky.social Early-Career Research Fellow at the John Innes Centre | Wellcome Project Leader
Studying Chromatin structure dynamics that adapt plants to their environment. 🌱
Carlotta (Lottie) Wills @lottiewills.bsky.social Postdoctoral research assistant in the Ashe Lab, based in the Charles Perkins Centre at the University of Sydney, interested in epigenetics and biomolecular condensates!
VCCC Alliance @vcccalliance.bsky.social The Victorian Comprehensive Cancer Centre Alliance in Melbourne, Australia is a collective of 10 major hospitals, research and academic institutions working together to overcome cancer.
@markjcowley.bsky.social @markjcowley.bsky.social 
Nicolas Nesi @nicolasnesi.eurosky.social Phylogenomics fruitbats 🦇 | Metatranscriptomics respiratory microbiome | Genomics bacteria 🦠
IR Inserm UMR 1311 DYNAMICURE Université Caen Normandie - CHU Caen- J Jason Merkin @jasonmerkin.bsky.social dad and scientist. wrestler and cyclist. probably too sarcastic for my own good.
Miles Collier @milescollier.bsky.social …I make no errors, mistakes or blunders…
#DJ 🎶 #Genomics 🧪🧬 #epigenetics 🧪 #epigenomics 🧪🧬 #funky #indie 🎶 #gigs 🎶 Anti- #ParentalAlienation 👨👩👧👦 Pro #EU 🇪🇺; #DJMilesy 🎶 #Cambridge, UK. Life is real good
Iliana Baums @ibaums.bsky.social Molecular Ecology, Evolution, Conservation - Corals; Professor of Marine Conservation at the Helmholtz Institute for functional marine biodiversity
Fiona Nielsen @glyndk.bsky.social Zorbian lifestyle with a twist - including amongst other things: sequencing, genomics and extreme project management.
Marios Gavrielatos @mariosgvr.bsky.social PhD student · Computational Biology · Koes Lab
Improving Generative models for Drug Discovery
Joel McGlothlin @joelmcglothlin.bsky.social Evolutionary biologist. Professor at Virginia Tech.