Lucía Magis-Weinberg @luciamawe.bsky.social Assistant Professor @University of Washington | PI of the interACTlab | teens and tech in Latin America | she/ella 
F. González @fegr-gr25.bsky.social Prof in Conditioning, Emotion and Motivation at @universidadgranada.bsky.social and @cimcyc.bsky.social
Esther Mondragón @e-mondragon.bsky.social Hic sunt dracones
I represent myself, no one else.
She/They
Computational and associative learning.
Biologically-inspired AI.
https://cit-ai.net/people.html#Mondragon
https://www.city.ac.uk/about/people/academics/esther-mondragon
Ernest Pons @epons.bsky.social Interested on #teaching and #learning. Dr. en #Economía con un Master en #Educación y #TIC. #Docència de #econometria a la @ub.edu. Ara Director de @idp-ub.bsky.social.
+info: https://sira.ub.edu/static/fitxes/EconomiaIEmpresa.html?id=epons.ub.edu&lang=en
Carlos Magro @carlosmagro.bsky.social Padre de dos: él/ella. 🏃♂️🚴♀️📚. De y en Madrid. Atleti. Recomiendo lecturas sobre educación aquí https://qrcd.org/7wK1 y escribo aquí https://carlosmagro.wordpress.com/ 🕷️
Jeni Kubota @jenikubota.bsky.social Assoc prof @UDelaware | social neuroscientist interested "us vs them" and "human vs AI" | Mexican, Indigenous, Japanese First Gen | #UDPBS | @UDPOSCIR | 🧠
https://www.ifsnlab.org/
Esperanza García Sancho @esperanzags.bsky.social PhD in Psychology. Associate Professor at @InfoUMA
Research: #emotionregulation #emotionbeliefs #emotiongoals #emotionaldisorders #anger #rumination
https://about.me/esperanzagarciasancho
GamblingHarm.org @gamblingharm.org An educational platform to reduce gambling-related harm for people globally.
gamblingharm.org
The Betting Truth @thebettingtruth.bsky.social Sharing the often-hidden truths about gambling addiction. We provide information, support, and pathways to recovery. Join the conversation.
#GamblingAddiction, #ProblemGambling, #Recovery, #GamblingAwareness, #GetHelp,
Alexandre Heeren @alexandreheeren.bsky.social Prof @UCLouvain & Research Associate @FNRS interested in #Psychopathology, Anxiety Disorders; Cognitive & Affective Processes of Anxiety ; Climate Change & Mental Health, Climate Anxiety/ #Eco-Anxiety (he/him) 🇧🇪
Elisa Wegmann @elisa-froschlilie.bsky.social Post-Doctoral Research Fellow, Cognitive Psychology @Unidue.bsky.social
Interested in Social Media Use, Addiction Research and Problematic Online Behaviors
(She/Her)
Cityzendogs 🐼🌎🏳️🌈🏳️⚧️ @zdog.eurosky.social La conducta es fascinante.
Adrián S. Elliott @aselliott.bsky.social Psicología, Neurociencia cognitiva y Neuropsicología, Filosofía. Devoro palomitas y opiniones. A ver qué tal se da el PhD.
(ES/EN/EO)
Ψ~🧠~🏴~🏴☠️~⛧
APA Division 28 @apadiv28.bsky.social The Society for Psychopharmacology and Substance Use
Javier Rodríguez Alcázar @javierralcazar.bsky.social Profesor de filosofía política. Universidad de Granada.
I teach political philosophy at the University of Granada.
Iker García @ikergarcia.eurosky.social PhD. Teaching Physiology and Embodying Boddhichita in the meantime.
Interested on Physical and Public Health.
Lights are on! Don’t take it for granted. 🌱
Itziar Alonso-Arbiol, PhD @ialonsoarbiol.bsky.social Professor of Psychology, University of the Basque Country UPV/EHU. I do research on emotions, relationships, and well-being. Attachment theory. Culture and gender also matter. Donostia-San Sebastian (Spain). https://orcid.org/0000-0002-4638-085X 
María Jesús Maraver @maravermj.bsky.social Spaniards y familia call me Chus
Cognitive Neuroscience @universidadjaen.bsky.social and @cimcyc.bsky.social
Jaén, Spain
Managing type 1 diabetes since 2004
Mind, Brain and Behavior Research Center - CIMCYC @cimcyc.bsky.social The Mind, Brain and Behavior Research Center at the University of Granada, an international hub for psychological and neuroscience research.
- Maria de Maeztu Unit of Excellence
- https://cimcyc.ugr.es/en
@tcollma.bsky.social @tcollma.bsky.social University of Granada (cimcyc) - Psychology research - #ADHD #TDAH
Bill Puerta @sinescudo.bsky.social "Un meme en formato humano"
Psicología, libros y ansiedad.
Cintia Refojo @desayunodudas.bsky.social Comunicación científica, monos y crisis existenciales. #SciComm
| FECYT | SciComm_ES | @aecomcientifica.bsky.social | @scicommcentre.eu |
Undi @idnu.eurosky.social Sí, soy yo. Legítima y acreditada. Rechace imitaciones. Ella/she/they. Persona. Antifascista.
Alberto Martín @albertomartin.bsky.social Associate professor at University of Granada (Spain), Dept #InformationScience & #LibraryScience. Interested in #bibliometrics, #scholarlycommunication, #openscience.
Miquel Torregrossa @miktorregrossa.bsky.social Catedràtic de Psicologia de l'Esport, Gausac, Culer i altres vicis
Nature Communications @natcomms.nature.com Nature Communications is an open access journal publishing high-quality research in all areas of the biological, physical, chemical, clinical, social, and Earth sciences.
www.nature.com/ncomms/
Ministerio de Educación, Formación Profesional y Deportes @educaciongob.bsky.social Ministerio de Educación, Formación Profesional y Deportes. Gobierno de España🇪🇸 💼 milagrostolon.bsky.social
Helena Matute @helenamatute.bsky.social Catedrática de psicología. Investigo creencias erróneas y sesgos cognitivos en humanos y en inteligencias artificiales. También la influencia de la IA en las decisiones humanas.
Autora de "Nuestra Mente nos Engaña".
https://helenamatute.wordpress.com/
Miguel Vadillo @mavadillo.bsky.social Experimental psychologist | Working on learning, memory, cognition, evidence synthesis, reproducible research and more | https://mvadillo.com/
QJEP @qjep.bsky.social The Quarterly Journal of Experimental Psychology is the journal of the Experimental Psychology Society and publishes scientific research in experimental and cognitive psychology. Account managed by Editor Antonia Hamilton
Monika Salgueiro @monikasalgueiro.bsky.social Con K y sin tilde. Enseño a veces y aprendo siempre. También me equivoco a menudo. #Psicologia en @upvehu.bsky.social (ella/she/her).
Samuel P León @samuelpleon.bsky.social Profesor de Métodos de Investigación y Diagnóstico en Educación de la Universidad de Jaén | PhD en Psicología, PhD en Educación, y Licenciado en Psicopedagogía.
Belén FC @belenfc2.bsky.social Psychologist - Methodologist - Meta-Analyist. Assistant Professor at UNED (Spain)
Javier Salas @javisalas.bsky.social Periodista - El País
Redactor jefe de Sociedad y Ciencia (Medio ambiente, tecnología, igualdad, educación, salud...)
Premio Ortega y Gasset | Kavli Award
jsalas@elpais.es
https://elpais.com/autor/javier-salas-quesada/
Ana Paqui Palenciano @palencianoap.bsky.social Cognitive neuroscientist interested in how humans achieve complex tasks 🧠. Postdoc at @cimcyc.bsky.social - UGR (Granada, Spain)
I work with neuroimaging and pattern analyses.
Oscar Lecuona @oscarlecuona.bsky.social Assistant Professor at @UCM_Psico
https://linktr.ee/oscar.lecuona
#mindfulness | #nonmonogamous | #networkanalysis | #psychometrics | #metascience
@oscarlecuona@fediscience.org
Spiral out, keep going.
Nature Neuroscience @natneuro.nature.com News, commentary and research coverage from the international monthly journal publishing the highest quality of work in all areas of neuroscience.
https://www.nature.com/neuro/
Nature Reviews Neuroscience @natrevneuro.nature.com Nature Reviews Neuroscience features reviews, perspective articles and the latest research news.
https://www.nature.com/nrn/
Joseph LeDoux @theamygdaloid.bsky.social Neuroscientist, and musician in The Amygdaloids
GEPE - Grup d'Estudis de Psicologia de l'Esport @uab-gepe.bsky.social Compte del Grup d'Estudis de Psicologia de l'Esport, equip de recerca actualment integrat en el Grup de Recerca en Ciències Socials de l'Esport (GRECSE) de l'Institut de Recerca de l'Esport de la UAB
Roser Nadal @rosernadal.bsky.social Professor of Psychobiology at the Universitat Autònoma de Barcelona. Member of the Institut de Neurociències UAB.
Lorena Sánchez Chamorro @laststrawberry.bsky.social Postdoctoral researcher at @UTwente. Manipulative design and vulnerabilities. HCI, privacy and societal impact of tech. Research through care. Freak. 🏳️🌈
Ignacio Obeso @iobeso.bsky.social Cognitive scientist working on cognitive control and habits (fMRI, neuromodulation), music, water, bread and books!
www.controlandhabit.com
Lucas Palmer @lucas-palmer.bsky.social Cog-sci PhD student at the Centre for Gambling Research, UBC. Investigating harmful/addictive design features across digital products with an interest in embodied and enactive cognition.
Psicóloga Diana Alonso @dianaalonsof.bsky.social Psicóloga especializada en trastornos adictivos, (juego patológico). Terapia individual o pareja online. www.psicologadianaalonso.com
Carmen Callizo @callizocarmen.bsky.social ▪︎ Philosopher & Ph.D. in psychology ▪︎
Culture | Religion | Time | Forgiveness
Diana Ho @hodiana.bsky.social Clinical Psych PhD at the University of Rhode Island 🐏 | UCLA Alum 🐻 | studying substance use among marginalized populations #addictionscience 🧠 | she/hers | views are my own
Guido Corradi @guidobcor.bsky.social Psicología y ciencia. Social Psychology. Public Toilet scientist. Currently working on interaction of AI and humans
Lorek7 @lorek7.bsky.social Psicóloga Clínica. Lo sé casi todo sobre adicciones ilegales y salud mental. El resto es la vida: viajar, mirar el cielo, amig@s y leer.
Esther Laso @estherlaso.bsky.social Psicóloga. Me gusta la ciencia y los gatos
Pepe Colubi @pepecolubi.bsky.social Soy biodegradable.
Aquí tienes los 50 episodios de THE BUCKET, mi podcast sobre reggae:
https://www.ivoox.com/podcast-the-bucket_sq_f1741594_1.html
Héctor García Barnés @hectorgbarnes.bsky.social Jefe de Reportajes en El Confidencial y colaborador de Ruta 66. Publiqué "Futurofobia". Me gustaría ser recordado como el chico de los pies de foto graciosos. Straight outta Möstoles
Yasmina Okan @yasminaokan.bsky.social Ramón y Cajal Senior Research Fellow, Department of Communication, Universitat Pompeu Fabra @upf.edu
Behavioral scientist studying #healthcommunication #riskcommunication #decisionmaking
Thomas Zandonai @zandopoll.bsky.social Head of Pharmacology, Health, and Addiction in Exercise Laboratory (PHAE Lab). Miguel Hernández University of Elche, Spain. Ramón y Cajal Fellowship. PhD in Translational Biomedicine. Neuropsychopharmacology; Exercise; Addiction. ETDAH
Virve Marionneau @virvemarionneau.bsky.social Director of Centre for Research on Addiction, Control and Governance (CEACG) at the University of Helsinki, Finland | Sociologist | Gambling research
PSOE de Andalucía @psoedeandalucia.bsky.social Cuenta no oficial (por ahora) 🌹 | Militancia activa por un PSOE andaluz renovado, inclusivo y netamente socialista ✊ | Por y para Andalucía.
Rodrigo Portela @rodericus.bsky.social Ahora uso esta cuenta:
I'm now using this account:
👉 @bsky.rodericus.net
The Addiction Psychologist @addpsychpodcast.bsky.social Official podcast of @apadivision50.bsky.social. Co-hosts @noahemery.bsky.social and @samuelacuff.bsky.social have discussions with researchers, clinicians, and policymakers about addiction.
Find us anywhere you get your podcasts!
Amandine Luquiens @luquiensa.bsky.social Full Professor of Addiction at the University of Montpellier, Psychiatrist specialising in addiction at the University Hospital of Nîmes, France. CESP-Inserm U1018
Posts are my own. RT ≠ endorsement
Jackie.olden @jackie-olden.bsky.social Not anti-gambling, just pro safer gambling.
Read why here: https://www.theguardian.com/society/2024/mar/17/in-the-grip-of-slot-machine-addiction-id-keep-loading-20s-in-i-could-be-in-a-daze
Riitta Matilainen @riittamatilainen.bsky.social Head of the gambling harm prevention unit at the EHYT ry.
Chair of the European Gambling Harm Prevention Network.
An economic and social historian (PhD in Soc.Sci).
https://www.linkedin.com/in/riitta-matilainen-2435465/
Sarah Ramanauskas @hundredgrapes.bsky.social Works to prevent gambling harms / lives in Paris / likes wine, books and food.
Manu Machimbarrena @machimbarrena.bsky.social Ph.D in Psychology. Associate professor @upvehu.bsky.social Research on media use & relation to adolescents' health. Human being in a continous learning experience
Academic Forum for the Study of Gambling @afsguk.bsky.social Advancing the research needed to effectively prevent, reduce, and address gambling harm.
meri @minimeri.eurosky.social • A warm heart with a free soul • •Woman in Tech · GIF Sensei · Design · Neuroscience · Horses · Cats • • Nolite Te Bastardes Carborundorum • GCAAGGACATATGGGCGAAGGAGA 🏳️🌈 ❤️💜💙
Raúl Gay @rgaynavarro.bsky.social Padre de Vega
(Casi) graduado en Psicología en la UOC
Autor de "Retrón. Querer es poder (a veces)" http://nextdoorpublishers.com/libros/retron/
Nacho Guadix @nachoguadix.bsky.social Educación/ Derechos Digitales de la Infancia en @unicef_es
Aquí escucho más que escribo. Más en:
http://www.linkedin.com/in/nacho-guadix
Jay 🦋 @jay.bsky.team Founder & Chief Innovation Officer @ Bluesky
Working on @attie.ai
🌱 🪴 🌳
Quentin Huys @docqhuys.bsky.social Professor of Computational Psychiatry @UCL. www.acplab.org. CI of RELMED study relmed.bsky.social / relmed.ac.uk.
allen institute @alleninstitute.org accelerating science for a healthier world
Susan G Walling 🇨🇦🍁🇨🇦 @wallingneurosci.bsky.social Neuroscience @Memorial University of Newfoundland. Locus coeruleus, norepinephrine, hippocampus, dentate gyrus, entorhinal cortex, glia, sex diff, aging, pre-tangle tau, Alzheimer’s disease. Also dogs, food, nature, flowers, music, fiddle, Gaeilge learner.
Valeria Gonzalez, PhD @vgonzalez.bsky.social Behavioral neuroscientist with interest in decision-making and (ir)rationality.
Assistant Professor at Reed College #newPI
Former postdoc at Izquierdo Lab UCLA
🇨🇱
https://www.vgonzalezlab.com/home
Carl Erik Fisher @drcarlerik.bsky.social Addiction psychiatrist, bioethicist, associate professor at Columbia University. | The Urge: Our History of Addiction (Penguin Press, 2022) | Rat Park newsletter--> carlerikfisher.substack.com
Juan Ramos-Cejudo, PhD @jramoscejudo.bsky.social Associate Professor at UCJC, Visiting Scholar at Stanford University, researching individual differences in emotion regulation, cognitive control, and metacognition. Cofounder and CEO of Mind Group 
Matti Vuorre @matti.vuorre.com I am an assistant professor at Tilburg University's Department of Social Psychology.
I have a website at https://vuorre.com.
All posts are posts.
Emilio Verche @everche.bsky.social 💼 Neuropsychologist 🧠 Brain enthusiast 🎓 Psychobiology lecturer at UCM 🔎 Researcher 🔬 Science communication 💡 Lifelong learner ⚜️ Scout volunteer 🇮🇨 Canary Islands spirit
Raimundo Aguayo @raguayo.bsky.social Lecturer at @unicomplutense.bsky.social |
Psychological quantitative methods. Psychometrics. Meta-analysis.
Dr Lucy Foulkes @lucyfoulkes.bsky.social Psychologist at University of Oxford | Adolescence + mental health
Linktr.ee/lucyfoulkes
Peters Lab @peterslab.bsky.social Biopsychology Lab at University of Cologne - Decision Neuroscience - Gambling - Reinforcement Learning
Guillaume Sescousse @gsescousse.bsky.social Cognitive neuroscientist interested in decision-making, dopamine and addiction. Working at Inserm.
Berna Devezer @devezer.bsky.social Metascientist @ uidaho. Behavioral sciences, stats, modeling, phil of science. Cat slave, cook, sailor (see: https://bsky.app/profile/kumrusails.bsky.social), photographer, clarinet student, adventurer, nature lover. Allergic to unsolicited advice.
Mark Haselgrove @markhaselgrove.bsky.social Professor of Experimental Psychology at the University of Nottingham. Interested in associative learning, and its application to all manner of stuff. Not really interested in brains. He/him.
https://scholar.google.co.uk/citations?user=fObPQPsAAAAJ&hl=en
Professor Sally Gainsbury @drsalgainsbury.bsky.social Academic psychology researcher at the University of Sydney Brain and Mind Centre.
My goal is to conduct research, share findings, & collaborate across diverse stakeholders to inform & evaluate policies & practices to minimise gambling harm.
Michael Inzlicht @minzlicht.bsky.social Professor (michaelinzlicht.com), Podcaster (www.fourbeers.com), Writer (www.speakandregret.michaelinzlicht.com)
Richard D. Morey @richarddmorey.bsky.social Statistics, cognitive modelling, and other sundry things. Mastodon: @richarddmorey@tech.lgbt
[I deleted my twitter account]
Nick Ballou @nballou.bsky.social Early career research fellow at Imperial College London - video games, trace data, adolescents, mental health, open research.
Carlos González-García @gonzalezgarcia.bsky.social Cognitive (neuro)scientist @ University of Granada
https://ugr.es/~cgonzalez/
Elizabeth Page-Gould: Black Lives Matter @page-gould.bsky.social Abolitionist, Big Nerd, Spouse and Mother of Interesting Humans, Good Vibes Fairy Godmother, she/her 🏳️🌈💖🦄
Alex Wiegmann @alexwiegmann.bsky.social Philosopher/Cognitive Scientist at University of Heidelberg (previously Gottingen/Bochum/Granada). Interested in deceptive communication, morality, AI, open science and stuff.
Eric Turkheimer @ent3c.bsky.social Behavior genetics, clinical psychology, Mets. Occasional politics.
Substack (free): https://ericturkheimer.substack.com/
Book Is Out! Understanding the Nature-Nurture Debate
https://shorturl.at/Ce2hf
Electronic Version: https://shorturl.at/Fq2jv
Kristoffer Magnusson @rpsychologist.com Mostly stats, visualization, open science, and psychotherapy.
https://rpsychologist.com
Nora Newcombe @noranewcombe.bsky.social Cognitive and developmental scientist at Temple University 
Daniel Simons @profsimons.bsky.social Cognitive psychologist, co-author of NOBODY'S FOOL and THE INVISIBLE GORILLA. Fond of wearing gorilla suits in public.
Olivia Guest · Ολίβια Γκεστ @olivia.science 👁️ https://olivia.science
🍃 https://metatheory.space
associate professor of computational cognitive science · she/they · cypriot/kıbrıslı/κυπραία · σὺν Ἀθηνᾷ καὶ χεῖρα κίνει
Ed Yong @edyong209.bsky.social Writer, journalist. Science, health. Pandemics, animals. Birder, photographer. Many words, some awards. AN IMMENSE WORLD, I CONTAIN MULTITUDES. Married to Liz Neeley, parent to Typo. he/him
📷 Canon R6mkii + RF 800mm
Edyong.me